![]() These samples were also not included in the analysis. Eight samples showed double signals at positions later identified as polymorphic, indicating multiple infections. Five samples could not be sequenced with at least one of the four primers used and these were not included in the final analysis. Sequences were deposited in the Genbank database. Sequencing was performed by Baseclear, Leiden, The Netherlands. The latter primers were designed based on preliminary sequencing results which showed that these parts of the gene were fully conserved. Additionally, internal primers 2371F, GGTCCACGATAC and 2370R, TGGTTGATCTGAAGCGCT were used. The same primers were used for sequencing the full-length pkama1 coding region. PCR products were purified using Gel/PCR DNA Fragment Extraction kit (Geneaid, Taiwan) and eluted using 20 μl of elution buffer. Amplification was for 35 rounds, with denaturing at 98☌ for 7 s, annealing at 63☌ for 20 s and elongation at 72☌ for 52 s. PCR amplification was undertaken with the Phusion High-Fidelity DNA Polymerase PCR Kit (Thermo Scientific, USA). knowlesi ama1 gene was amplified from 65 samples using primers 2334F, GCTACCTGAACTCGGTTGCTA (starting 102 bp upstream from the start codon ATG) and 2335R, ACACCCACAGTTGTTACGACC (ending 57 bp after the stop codon). DNA was extracted from the blood samples using the QIAamp DNA Blood Midi Kit (Qiagen, Germany). This study was approved by the Medical Ethics Committee of Universiti Malaysia Sarawak. The distance between Kapit Hospital and Betong Hospital is 233 km. Sample collection: Blood samples were collected from Plasmodium knowlesi malaria patients at Kapit Hospital and Betong Hospital, Sarawak, Malaysia, after written informed consent was obtained. knowlesi isolates derived from human infections was sequenced and analysed. In order to determine genetic diversity of the ama1 gene and to identify epitopes on AMA1 under strongest immune selection, the ama1 gene of 52 P. vivax AMA1 are highly polymorphic molecules, requiring the development of vaccine strategies to overcome the diversity. knowlesi AMA1 (PkAMA1) showed that, after two booster immunizations, five out of six animals were able to control the parasitemia. A recent vaccination trial with rhesus monkeys using heterologously expressed P. Apical Membrane Antigen 1 (AMA1) is a promising vaccine candidate (reviewed in ). knowlesi warrants the development of a vaccine against P. The distribution and magnitude of infections by P. There are no biological barriers that would prevent transmission by mosquitoes from macaques to humans and from humans to humans, and this has been demonstrated under laboratory conditions. knowlesi is an ancient parasite that has been infecting humans for a long time, such infections are considered to be primarily a zoonotic event. knowlesi is considered a serious threat, responsible for approximately 66% of all hospitalized malaria cases for the year 2013 in Malaysian Borneo. knowlesi infections in humans were overlooked for a long time as they were misdiagnosed by microscopy as the morphologically similar P. Its distribution coincides largely with the distribution of its natural hosts, the long-tailed and pig-tailed macaques, and the Anopheline vectors belonging to the Anopheles leucosphyrus group. In the last decade it has become increasingly clear that the simian malaria parasite, Plasmodium knowlesi, is widely distributed in Southeast Asia and can cause severe disease and death in humans. * E-mail: (BWF) (BS)Īffiliation: Department of Parasitology, Biomedical Primate Research Centre, Rijswijk, The NetherlandsĪffiliation: Malaria Research Centre, Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak, Kuching, Sarawak, MalaysiaĬurrent address: Institut Pasteur, Plate-forme de Cristallographie, Département de Biologie Structurale et Chimie, CNRS UMR 3528, Paris, FranceĪffiliations Institut Pasteur, Unité d’Immunologie Structurale, Département de Biologie Structurale et Chimie, Paris, France, CNRS URA 2185, Paris, FranceĬurrent address: Institut Pasteur, Unité de Microbiologie Structurale, Département de Biologie Structurale et Chimie, CNRS UMR 3528, Université Paris Diderot, Sorbonne Paris Cité, Microbiologie Structurale, Paris, FranceĬurrent address: Institut Pasteur, Paris, France
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |